jay0626 jay0626
  • 03-02-2019
  • Biology
contestada

how is cell divison controlled?

Respuesta :

alexandra2442
alexandra2442 alexandra2442
  • 03-02-2019
Cell controls on division contact with other cells once DNA (cell directions) is copied, cell divides sequence of steps
Answer Link

Otras preguntas

How did a thriving economy support artists in Italy
who is father of biology​
nfkxcdzncldnkcnzcnm...
Write an absolute value inequality to model the situation described: The price for a certain box of Legos varies based on demand. The average price is $39 but i
How do mitochondria support cellular functions? O They store the genetic information. o They produce proteins. o They convert energy from the sun into glucose.
during which section did the person travel the farthest ? how far did they travel ? ​
There is a line whose slope is 0 and whose y-intercept is 2. What is its equation in slope-intercept form?
A farm lets you pick 4 pints of raspberries for $12.00 How much dollars for 1 pint? No websites pls
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
need help plz help meh