deno305 deno305

02-04-2020
Social Studies

contestada

Why was the older prisoner so sure steve would get time?

Respuesta :

almightyeli almightyeli

02-04-2020

Answer:

because he commited a crime and hes been through it

Explanation:

Answer Link

Otras preguntas

Brad Paisley Katy Perry Can you determine the target market for each site?

(2+2)-(45+67)=x solve for x

Figurative Language. This is due by 7 and it's 5:30, I need some help T^T

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

narration ;the boy said "it is my birthday."

In 2006, an Ethiopian researcher announced the discovery of well-preserved 3.3 million-year-old fossil of a young female hominid. Refer to Figure (F) below. Con

At what location did Siddhartha find the answers he was looking for?

13 yd 5 yd 11 yd 9 yd 6 yd BE ?

PLEASE HELP IVE BEEN STRUGGLING SO BAD PLEASE 15 points please What is the slope of a line that is perpendicular to the line y=1/5x+2

i need help plzz if you answer i will give you a thank and 5 star and brillants