20cjuarez 20cjuarez

01-05-2020
Physics

contestada

what is the definition of eletric field

Respuesta :

esakeya01 esakeya01

01-05-2020

Answer:

a region around a charged particle or object within which a force would be exerted on other charged particles or objects.

Explanation:

Answer Link

Otras preguntas

a rock has a density of 17 g/cm3. If it is cut into 3 equal size pieces, what will be the density of each piece?

x^(2)+x^(2)=128 or x^2+x^2=128

Write the equation of the line that is parallel to the line 2x + 5y = 15 and passes through the point (-10, 1)

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

what is represented on the x-axis and it's units ?

Look for relationships what relationship ps among the measures of the angles do you see?

Read the excerpt from Spencer's narrative. As we waited for our new football coach to enter the locker room, we all secretly wondered what he would be like. Wou

Need help with this math please

what does the term normal imply when used in Alkanes?

Who was Queen Nzinga? Why and how did she resist the Portuguese?