itsraii
itsraii itsraii
  • 01-05-2020
  • Mathematics
contestada

Guys help me:( please

Guys help me please class=

Respuesta :

riyannahall06
riyannahall06 riyannahall06
  • 01-05-2020

Answer:

A) An expression

B) A term

C) A constant

D) A variable

E) A coefficient

2. Yes

3. 12, -9xy, +y, -x²y

Step-by-step explanation:

Answer Link

Otras preguntas

i just need answers for these questions thank you!!
a child who is punished for swearing at home but reinforced for swearing on the school playground is most likely to demonstrate a patterned habit of swearing th
Answer the following: 1.) How can the use of estimates be abused by accountants? What are its effects on the financial statements? 2.) Why should an accountant
Can you help If your right you the brain thing or what ever
describe the ideology of republicanism. as a political philosophy, how did republicanism compare to the system that prevailed in great britain?
y=y, equals x+x+x, plus graph
4n + 12 = 4 show work and explain. solving two step equations
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Brief Statement of Intro and Purpose: What is the CRAAP test, and why should anyone care?​
7. Red and white paint is mixed in the ratio of 3 to 2. B) how many cans of each colour are needed to make 20cans of mixture