desiprice45 desiprice45

03-03-2021
Biology

contestada

Which of the following correctly indicates the order in which these events occur?

Which of the following correctly indicates the order in which these events occur class=

Respuesta :

alicewren alicewren

03-03-2021

Answer:

The third one

Explanation:

Because its right

Answer Link

Otras preguntas

The ratio of the number of muffins Baker A baked to the number of muffins Baker B baked was 8:5. The ratio of the number of muffins Baker B baked to the number

What did the Fugitive Slave Act cause some abolitionists to do

UESTION 3 Researchers discovered that the curved carapace (shell) length of these turtles is approximately normally distributed with a mean of 55.7 centimeters

Trevor sees 8 red birds. He sees 5 more red birds than blue birds hkw many. Blue birds does trevor see

A growth medium is inoculated with 1,000 bacteria, witch grow at rate of 15% each day. What is the population of the culture 6 days after inoculation?

What is the common ratio of the sequence? -2, 6, -18, 54,... 0 -3 O -2 3 08

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Which of the following does not take place in the game of economics? A. Distribution B. Production C. Evaluation D. Consumption

What organelle is number 3

find the median 2.3, 0.9, 2.5, 0.7, 1.6, 1 PLS HELP !!!!!!!!!