pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Tu prima Gabriela ahora! _(tener, imperfecto) dos años cuando la conocí. iQué grande está ahora! A.tenía B.tuvo C.tenías D.tuve
Someone help. Questions 2 and 3
A law office used 27 reams of paper in the last six days how many reams of paper did they use per pay.
Do you think we make false assumptions that people are up to no good if they are on the street late at night, even if they have a good reason for doing so?
how does the constitution relate to other laws
Which sources do scientists use to study ancient climates? Check all that apply
Evidence shows that Modern Humans were in Western Europe before the Neanderthals. : True False
(9× 3) = (__x 3) + (__x 3) = __ + ____ = ___
9. Jorge ran 15 miles in 3 1/2 hours. What was his rate in miles per hour?​
write 12 as a product of three primes