kmx7 kmx7
  • 02-03-2022
  • English
contestada

need answers urgent


50 points ​

need answers urgent 50 points class=

Respuesta :

ghostsophiagrace ghostsophiagrace
  • 10-03-2022

Answer:

This is 8 points, not 50. But hey, I'll take it!

Answer Link

Otras preguntas

Name all of the traits that the mackerel has, based on this cladogram.
What role did John Marshall serve in the new government? A. Head of Congress B. President C. Chief Justice D. Vice president Answer is C.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
For how many different values of θ between 0 and 2π radians is sec x = csc x ?
The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?
What is the solution 4x+1y ≤48 and 10 ≤y ?
Why was the Neolithic revolution important
The national competency-based credential for entry-level early childhood educators is called?
I=$310 P=$1,000 t=5 years
Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa