ddarius2513 ddarius2513
  • 04-03-2022
  • Computers and Technology
contestada

Authenticating information can be something a user knows, like a password; something a user has, like a smart card; or something a user is, like a fingerprint. True False

Respuesta :

srisri24
srisri24 srisri24
  • 15-03-2022

Answer:. True

Explanation:

yes it is true in my opinion

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
speed and velocity are same because... speed and velocity are different because...​
What points should you remember throughout your job search process? Select an answer: A). Resumes are subjective and will get you a job interview, not the job.
solve the following inequality 2x + 1 < 5
how does ATP enter the body during cellular respiration
This is very important, please help mee :)
NF or EminemIf you don't know who NF is please listen to him​
what is the gcf of 10 26 and 38
if f(x)= -x^2-3x+5, find f(-3)
How was the organization of the government under the United States Constitution different from the system under the Articles of Confederation?